View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3030_low_53 (Length: 243)

Name: NF3030_low_53
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3030_low_53
NF3030_low_53
[»] chr8 (1 HSPs)
chr8 (9-224)||(9051302-9051517)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 9051302 - 9051517
Alignment:
9 ggacatcatcaattggaaatgaagatgaacttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaatagaggaagggcttc 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
9051302 ggacatcatcaattggaaatgaagatgaacttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaataggggaagggcttc 9051401  T
109 aaccgatcaaagagactctattaagactgtggaagtcgacacatctcaaccttattcatatctaggagcaaattacagaagatcacatccaaattatcaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9051402 aaccgatcaaagagactctattaagactgtggaagtcgacacatctcaaccttattcatatctaggagcaaattacagaagatcacatccaaattatcaa 9051501  T
209 tataatccacatcacc 224  Q
    ||||||||||||||||    
9051502 tataatccacatcacc 9051517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University