View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_low_56 (Length: 240)
Name: NF3030_low_56
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 329051 - 328830
Alignment:
| Q |
1 |
tgacttattttaaaataaatggttctggcgtttcgtgt-acgggcattcgtaatgaatagcatctctcttcaaataataatgacacactcccaatcattc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
329051 |
tgacttattttaaaataaatggttctggcgtttcgtgttacgggcattcgtaatgaatagcatctcatttcaaataataatgacacactcccaatcattc |
328952 |
T |
 |
| Q |
100 |
acattgcaaaaactcttggaggggcaattatgagctgatgcgattgcggcccacaaccacaatattgaagccacggccatataatgaaaattttaatcaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
328951 |
acattgcaaaaactcttggaggggcaattgtgagctgatgcgattgcggcccacaaccacaatattgaagccacggccatataatgaaaattttaatcaa |
328852 |
T |
 |
| Q |
200 |
aagttataatgatgcactcacg |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
328851 |
aagttataatgatgcactcacg |
328830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University