View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_low_60 (Length: 237)
Name: NF3030_low_60
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 3260114 - 3259892
Alignment:
| Q |
1 |
aaagtcatataatttataa-taaactttaaatatattgaatttatccatggtctaactatcaatcaccagttctaaggatgcatgcattaacattagtag |
99 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3260114 |
aaagtgatataatttataaataaactttaactatattgaatttatccatggtctaaccatcaatcaccagttctaaggatgcatgcattaacattagtag |
3260015 |
T |
|
| Q |
100 |
gatattttttggcacctcctgaccaaaaaatacgtggttcaaaataatcccttaagaaaaaagtcataaatacttatcgacaattaggcacattatttaa |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3260014 |
gatattttgtggcacctcctgaccaaaaaatacgtggttcaaaatagtcccttaagaaaaaagtcataaatacttatcgacaattaggcacattatctaa |
3259915 |
T |
|
| Q |
200 |
atgacatgtcaacatcttaaact |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3259914 |
atgacatgtcaacatcttaaact |
3259892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University