View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3030_low_64 (Length: 227)
Name: NF3030_low_64
Description: NF3030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3030_low_64 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 329570 - 329346
Alignment:
| Q |
1 |
atattagctagtaaaaatcatagaagggtttaatttgcttacaggagcaatcagcaaatgatggaatcaaactgaactgggctgaccttagagaacttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329570 |
atattagctagtaaaaatcatagaagggtttagtttgcttacaggagcaatcagcaaatgatggaatcaaactgaactgggctgaccttagagaacttct |
329471 |
T |
 |
| Q |
101 |
tgtccctttcgtagtcaaggcctggaggtgcattttgcaaagtcataagcagtacctggaaagtttaattattatgaaattaaacaaagaaaaatggaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
329470 |
tgtccctttcgtagtcaaggcctggaggtgcattttgcaaagtcataagcagtacctggaaagtttaattattatgaaattaaac--agaaaaatgggat |
329373 |
T |
 |
| Q |
201 |
aaaattttgagtgcttatagcaaatac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
329372 |
aaaattttgagtgcttatagcaaatac |
329346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 98 - 151
Target Start/End: Original strand, 1202352 - 1202405
Alignment:
| Q |
98 |
tcttgtccctttcgtagtcaaggcctggaggtgcattttgcaaagtcataagca |
151 |
Q |
| |
|
||||||| ||||| || ||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
1202352 |
tcttgtctctttcataatcaagacctggaggggcattctgcaaagtcataagca |
1202405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University