View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3031_low_10 (Length: 250)
Name: NF3031_low_10
Description: NF3031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3031_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 21 - 201
Target Start/End: Complemental strand, 37167235 - 37167058
Alignment:
| Q |
21 |
tcagaaatattcaataatgtaaatttggacacacacatgcatatacgtacgtgcgggcatattatgcattgggatggccagtattccttttcaatacaag |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| | |||||| ||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
37167235 |
tcagaaatattcaataatgtaaatttggacacacaca--catacatatacgtgtgggcatattatacattgggatggccaggattccttttcaatacaag |
37167138 |
T |
 |
| Q |
121 |
caacttttctttttcaaagatatagttaaaataacttataatgaatttttataacgaatatcttcaaatatatgttttgtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
37167137 |
caacttttctttttcaaagatatagttaaaaaaacttataatgagttttt-taacgaatatcttctaatatatgttttgtt |
37167058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University