View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3031_low_9 (Length: 251)
Name: NF3031_low_9
Description: NF3031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3031_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 181
Target Start/End: Complemental strand, 52086100 - 52085929
Alignment:
| Q |
15 |
gagcttgtattatgtagcaactaattaacaatctagtcacattagcagttgaatagggtttagannnnnnnnnnnnnn--gttacaaca---ttagaatt |
109 |
Q |
| |
|
|||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
52086100 |
gagcttatattatgtatcagctaattaacaatctagtcacattagcagttgaatagggtttagaatttttatttttttttgttacaacaatcttagaatt |
52086001 |
T |
 |
| Q |
110 |
caaatctaacataaatctgatattttaaattaattattaagataattatggtattcatagtatctttttatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52086000 |
caaatctaacataaatctgatattttaaattaattattaagataattatggtattcatagtatctttttatt |
52085929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 52085907 - 52085859
Alignment:
| Q |
203 |
cattcaatatgttgtatttctttttgtcgataattgcctatcttatatt |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52085907 |
cattcaatatcttgtatttctttttgtcgataattgcatatcttatatt |
52085859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University