View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_high_11 (Length: 381)
Name: NF3032_high_11
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 12 - 362
Target Start/End: Complemental strand, 37032646 - 37032308
Alignment:
| Q |
12 |
agcagagacttccggctcactgttgccggcaaaagcgacctcctttccacgacggctgtgctgccgtttgaagagctctcagattgattttccttcatct |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032646 |
agcacagacttccggctcactgttgccggcaaaagcgacctcctttccacgacggctgtgctgccgtttgaagagctctcagattgattttccttcatct |
37032547 |
T |
 |
| Q |
112 |
ttttgcggcgtttgataagacgtaactctttcttctcattggtacccacttcagcaaatttccttagtagctcatcagaagatttctttgttactcgttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37032546 |
ttttgcggcgtttgataagacgtaactctttcttctcattggtacccacttcagcaaatttccttagtagctcgtcagaagatttctttgttactcgttg |
37032447 |
T |
 |
| Q |
212 |
aaccttagcatcagtagtagcagaagaagcagaggtagttgttggggcagtagagttgttagtttccattgcaagagagtaagaaaaatgttaatgaaaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37032446 |
aaccttagcatcagtagtagcagaagaagcagaggtagttgttggggcagtagagttgttagtttccattgcaagagagtaagaaaa------------a |
37032359 |
T |
 |
| Q |
312 |
tgtgagaaaaatgttaatatgatttgatggttttatgaggatggatggacc |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032358 |
tgtgagaaaaatgttaatatgatttgatggttttatgaggatggatggacc |
37032308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University