View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_high_20 (Length: 298)
Name: NF3032_high_20
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 5016335 - 5016609
Alignment:
| Q |
1 |
taaaacaacactttgagtatccaaccaagtagtcacaccaaatccatttcctactttcatatgtgccgtttggactttggtcaaaacccttaatgcttga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5016335 |
taaaacaacactt-gagtatccaaccaagtagtcacaccaaatccatttcctactttcatatgtgccgtttggactttggtcaaaaccctta-tgcttga |
5016432 |
T |
 |
| Q |
101 |
attcacagtttgccaccaattggctatacttcactctaggttataattgtaacactcgtaccttatatgaatatccctcactatggaaatcaagaacaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
5016433 |
attcacagtttgccaccaattggctatacttcactctaggttatagttgtaacactcgtaccttatacgaatatccctcactatggaaaccaagaacaag |
5016532 |
T |
 |
| Q |
201 |
gataagaatcacgaacccctggtattttattttatttttgtgttatttctaccaatatgttcaatcttctatttctt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5016533 |
gataagaatcacgaacccctggtattttattttatttttgtgttatttctaccaatatgttcaattttctatttctt |
5016609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University