View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_high_24 (Length: 285)
Name: NF3032_high_24
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 6 - 282
Target Start/End: Complemental strand, 40880214 - 40879938
Alignment:
| Q |
6 |
acagtcttgcctgaggagttgaacgctgcctccgtaagatagttgaaaaaatcacagggatgatgcttgcagcaatcaccacctcgatgacactcaggaa |
105 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40880214 |
acagtcttgcatgaggagttgaacgctgcctccgtaagatagttgaaaaaatcgcacggatgatgcttgcagcaatcaccacctcgatgacactcaggaa |
40880115 |
T |
 |
| Q |
106 |
ccaaaccacccatgttggagctcggtaggtggtgtagtcggagttgtcaaaatgtttggtgaaaaagacactatcgggtggctcattgaaggtgaatgtg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40880114 |
ccaaaccacccatgttggagctcggtagggggtgtaggcggagttgtcaaaatgtttggtgaaaaagacactatcgggtggctcattgaaggtgaatgtg |
40880015 |
T |
 |
| Q |
206 |
gggggttcactctcatacttgcttttggtgaaagacattgtgaaatggtgatgcagaagttgtgaggtatatatatt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40880014 |
gggggttcactctcatacttgcttttggtgaaagacattgtgaaatggtgatgcagaagttgtgaggtgtatatatt |
40879938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University