View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_high_25 (Length: 283)
Name: NF3032_high_25
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 26734448 - 26734717
Alignment:
| Q |
1 |
tgtcacgtcttgtgtcgatgctaataaataaaatttgtcgttgnnnnnnnnnntgaataagtggagaatttagatttgaacacgtcctacatataaaata |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
26734448 |
tgtcacgtcttctgtcgatgctaataaataaaatttgtcgttgaaaaaaaaaatgaataagaggagaatctggatttgaacacgtcctacatgtaaaata |
26734547 |
T |
 |
| Q |
101 |
caatgtccctgtcaactaagttatggttatgggacaaatattttctctctttgttagagcatgttcggattctcttttgtttgcagttgtatcgtttttt |
200 |
Q |
| |
|
|||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26734548 |
caatgtttctaccaactaagttatggtcatgggacaaatattttctctctttgttagagcatgttcggattct-ttttgtttgcagttgtatcgtttttt |
26734646 |
T |
 |
| Q |
201 |
ggttcaatttgggaaataaaccatcatgcatgacattcaggtgctttcatgtttcactacatacacaggtt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26734647 |
ggttcaatttgggaaataaaccatcatgcatgacattcaggtgctttcatgtttcactacatacacaggtt |
26734717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University