View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_high_33 (Length: 240)
Name: NF3032_high_33
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_high_33 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 139 - 240
Target Start/End: Complemental strand, 5175822 - 5175721
Alignment:
| Q |
139 |
gtaatttacaaatgtaaccattaagtaaatcaaataaaaagggatcaaattcagcaataagggcatgtttggtttgtaagggaagttagaaagagagtaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5175822 |
gtaatttacaaatgtaaccattaagtaaatgaaataaaaagggatcaaattcagcaataagggcatgtttggtttggaagggaagttagaaagagagtaa |
5175723 |
T |
|
| Q |
239 |
tg |
240 |
Q |
| |
|
|| |
|
|
| T |
5175722 |
tg |
5175721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 138
Target Start/End: Complemental strand, 5176447 - 5176328
Alignment:
| Q |
20 |
ttcatcatctcgcaaattgcaacacaaatttttaataaatctcaacaagttcatatctcttgttttccttctctttttgcaagtttgcatgag-ttttat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| |||| | |
|
|
| T |
5176447 |
ttcatcatctcgcaaattgcaacacaaatctttaataaatctcacaaagttcatgtctcttgttttccttctctttttgcaagtttgtatgagttttttt |
5176348 |
T |
|
| Q |
119 |
tttccctttgctttggtatc |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5176347 |
tttccctttgctttggtatc |
5176328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 23 - 106
Target Start/End: Complemental strand, 5243912 - 5243829
Alignment:
| Q |
23 |
atcatctcgcaaattgcaacacaaatttttaataaatctcaacaagttcatatctcttgttttccttctctttttgcaagtttg |
106 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| ||||||||| |||| |||||| ||| |||||||||||||||| |
|
|
| T |
5243912 |
atcaactcgcaaattgcaacacaaatctttaataaatctcaccaagttcatgtctcatgtttttcttttctttttgcaagtttg |
5243829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University