View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_high_39 (Length: 227)
Name: NF3032_high_39
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_high_39 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 17439269 - 17439043
Alignment:
| Q |
1 |
acctttatgatccctttctaagaaaccccaagctgtcacaccattatcaaaacatccagcatcaatatttatcttagttgaacccatacctggcgcacac |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17439269 |
acctttatgatccctttctaagagtccccaagctgtcacaccattatcaaaacatccagcatcgatatttatcttagttgaacccatatctggcgcacac |
17439170 |
T |
 |
| Q |
101 |
caacaaggaggggccaaatgtgttccctggaccgtttcagaaatggtactatgagcaaattcattagcaaatccaacaatttctgctgctataaggggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| |||||||||||||||| ||||||| |
|
|
| T |
17439169 |
caacaaggaggggccaaatgtgttccctggaccgtttcagaaatggtactatgagtaaattcatcagtaaatccagcaatttctgctgctattaggggtg |
17439070 |
T |
 |
| Q |
201 |
gacagaacttttgtttattgagcacac |
227 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
17439069 |
gacagaacttttgtttattgaacacac |
17439043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 15055941 - 15056005
Alignment:
| Q |
5 |
ttatgatccctttctaagaaaccccaagctgtcacaccattatcaaaacatccagcatcaatatt |
69 |
Q |
| |
|
||||||||| |||||| | |||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
15055941 |
ttatgatccttttctattagtccccaagccgtgacaccattttcaaaacatccagcatcaatatt |
15056005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University