View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3032_high_46 (Length: 204)

Name: NF3032_high_46
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3032_high_46
NF3032_high_46
[»] chr7 (1 HSPs)
chr7 (16-194)||(12858300-12858478)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 194
Target Start/End: Original strand, 12858300 - 12858478
Alignment:
16 taacctatgtttctaagtcgaatccttccacaaattgaaacaatgaattgcggggccttccatactgatctacgtctattgaatgtgaacgtcttccgaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||    
12858300 taacctatgtttctaagtcgaatccttccacaaattgaaacaatgaaatgtggggccttccatactgatctacctctattgaatgtgaacgtcttccgaa 12858399  T
116 atacgttagaccccaaaatacttttcagctcaagttatacttttcatcacaattaatagccaccagctcaaccttcttc 194  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||    
12858400 atacgttagacctcaaaatacttttcagctcaagttatacttttcatcacaattaatggccactagctcaaccttcttc 12858478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University