View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_low_18 (Length: 325)
Name: NF3032_low_18
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_low_18 |
 | |
|
| [»] scaffold0627 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0627 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: scaffold0627
Description:
Target: scaffold0627; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 185 - 311
Target Start/End: Complemental strand, 6138 - 6013
Alignment:
| Q |
185 |
gagtcagtcttgtaacaaaaactaaataaaaattgacgagtctctcattctcaactagtaaaccttcacacttcccgatctttctttaccaacgcacaat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
6138 |
gagtcagtcttgtaacaaaaactaaataaaaattgacgagtctgtcattctcaactagtaaaccttcacagtt-ccgatctttctttaccaacgcacaat |
6040 |
T |
|
| Q |
285 |
tcttcaatttcgacccaaggtactttc |
311 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
6039 |
tcttcaatttgtacccaaggtactttc |
6013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0627; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 17 - 106
Target Start/End: Complemental strand, 6303 - 6214
Alignment:
| Q |
17 |
aatagtaaaattcacttgctatttctcctccaaagttgttactccctccattaaggacggatgaattaagatcctttttattaggcacta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6303 |
aatagtaaaattcacttgctatttctcctccaaagttgttactccctccattaaggacggatgaattaagatcctttttattaggcacta |
6214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University