View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_low_19 (Length: 323)
Name: NF3032_low_19
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 8 - 314
Target Start/End: Complemental strand, 13715597 - 13715300
Alignment:
| Q |
8 |
gtattttggtctctgcttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctcagcaacaa |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715597 |
gtattttggtctctgtttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctcagcaacaa |
13715498 |
T |
 |
| Q |
108 |
tataaatcaacctctcgacctatcatcttgggatattccgctgcattgctcgtagaatgtttggagccctccagtgaaacaaatcatgctttctgccaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715497 |
tataaatcaacctctcgacctatcatcttgggatattccgctacattgctcgtagaatgtttggagccctccagtgaaacaaatcatgctttctgccaag |
13715398 |
T |
 |
| Q |
208 |
cttcatactatttggattatttgggttgaacaaaacaaacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatttatgaag |
307 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715397 |
cttcat---------attatttgggttgaacaaaacagacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatttatgaag |
13715307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University