View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_low_38 (Length: 238)
Name: NF3032_low_38
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 25 - 221
Target Start/End: Original strand, 26791859 - 26792055
Alignment:
| Q |
25 |
ggttcacttgttacaatcacctgtaattaaaactttcatgctagaactcttttattagataaaatttatatagctttcatttcatcacaaaacgcgagat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
26791859 |
ggttcacttgttacaatcacctgtaattaaaactttaatgctagaactcttttattagataaaatttatatagctttcatttcatcacaaaacgtgggat |
26791958 |
T |
|
| Q |
125 |
tcaattctaaagtgtgagactcaaatgagtttcatccgtgattgttaaaagagtgttggtaagaaattgtctatagcactcattacccatcactaat |
221 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26791959 |
ttaattcttaagtgtgagactcaaatgagtttcatctgtgattgttaaaagagtgttggtaagaaattgtctatagcactcatcacccatcactaat |
26792055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 161
Target Start/End: Original strand, 36301850 - 36301889
Alignment:
| Q |
122 |
gattcaattctaaagtgtgagactcaaatgagtttcatcc |
161 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
36301850 |
gattcatttctaaagtgtgagactcacatgagtttcatcc |
36301889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University