View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_low_42 (Length: 227)
Name: NF3032_low_42
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 24135144 - 24135349
Alignment:
| Q |
1 |
aaaatcgattcaataattttcaaacaaattgtcggatcggtaaggtatctatgcaataacaagcctgacataagttttgtagttagcttaattagcagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24135144 |
aaaatcgattcaataattttcaaacaaattgtcggatcagcaaggtatctatgcaataacaagcctgacataagttttgtagttagcttaattagaa--- |
24135240 |
T |
 |
| Q |
101 |
tcatgtatgtttctagaaaatctcacatgaacgttgcaaggaggatgctcaggtatctaaataacaccatatgttattgtatcatgttcgtcgatcctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24135241 |
-catgtatgtttctagaaaatctcacatgaacgttgcaaggaggatgctcaggtatctaaataacaccatatgttattgtatcatgttcatcgatcctca |
24135339 |
T |
 |
| Q |
201 |
gaccaagaag |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
24135340 |
gaccaagaag |
24135349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University