View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_low_46 (Length: 221)
Name: NF3032_low_46
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 17438836 - 17438651
Alignment:
| Q |
17 |
caaagggggcagattgtgtccaaggaaatacctttcttttctagacgacctctggtagggagaatcaatttagccagcctccataagaaatttcgcacac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
17438836 |
caaagggggcagattgtgtccaaggaaatacctttcttttctagacggcctctggtagggagaatcaatttagccatcctccacaagaaattacgcacac |
17438737 |
T |
 |
| Q |
117 |
aattagggaccttcaacttccatattgccttccacaaaccttgatcatttgtagcagatgattccggattgttttgatcattcaga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17438736 |
aattagggaccttcaacttccatattgccttccacaaaccttgatcacttgtaacagatgattccggattgttttgatcattcaga |
17438651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 147
Target Start/End: Complemental strand, 9522415 - 9522315
Alignment:
| Q |
47 |
cctttcttttctagacgacctctggtagggagaatcaatttagccagcctccataagaaatttcgcacacaattagggaccttcaacttccatattgcct |
146 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| ||| || || ||||| ||||| |||||| |||||||||||||| ||||| ||| ||| |
|
|
| T |
9522415 |
cctttcttttctagtcgacctctggtggggagaatcagttttgcaagtctccacggaaaattatgcacactgttagggaccttcaatttccaaattacct |
9522316 |
T |
 |
| Q |
147 |
t |
147 |
Q |
| |
|
| |
|
|
| T |
9522315 |
t |
9522315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University