View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_low_47 (Length: 220)
Name: NF3032_low_47
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 30971635 - 30971420
Alignment:
| Q |
1 |
aataatataattttatgtcaccaaagcatatttaagaacaaaactagtctttttgaatagcatcatatggaatttagggacatgtcttaagttatatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30971635 |
aataatataattttatgtcaccaaagcatatttaagaacaaaactagtctttttgaatagcatcatatggaatttagggacatgtcttaagttatatata |
30971536 |
T |
|
| Q |
101 |
aaactaagtatgcgaatatttagtttttgtaaattataagtttgtggtttcct----nnnnnnnnnnntttgcggttgaattaagcatctttgatggaaa |
196 |
Q |
| |
|
||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
30971535 |
aaattaagtatgtgaatatttagtttttgtaaattataagtttgtggtttcctaaaaaaaaataaaaatttgcggctgaattaagcatcgttgatggaaa |
30971436 |
T |
|
| Q |
197 |
cataccatcgagttgt |
212 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30971435 |
cataccatcgagttgt |
30971420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University