View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3032_low_49 (Length: 206)
Name: NF3032_low_49
Description: NF3032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3032_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 190
Target Start/End: Original strand, 30243311 - 30243485
Alignment:
| Q |
16 |
caaagggctaatatgaggtgggcagcaatgcattttcgtggtcaaaacaatgcaactacacaaaacccatagggggacaccaatttaatattcccaccag |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30243311 |
caaagggctaatatgaggtggccagcaatgcattttcgtggtcaaaacaatgcaattacacaaaacccatagggggacaccaatttaatattcccaccag |
30243410 |
T |
 |
| Q |
116 |
gacacttcaacagggttctctactacgcatgtacacctccgagtagtacacaccatgacaagggatccaaggtta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30243411 |
gacacttcaacagggttctctactacgcatgtacacctccgagtagtacacaccatgacaagggatccaaggtta |
30243485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University