View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3033_low_4 (Length: 336)
Name: NF3033_low_4
Description: NF3033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3033_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 44986424 - 44986749
Alignment:
| Q |
1 |
gtcttggacgacaatgttgtcttctttagtggaaaatggtaaatggggtgaagcttttgaaatctatcttaaaatgattgaattgggtgtttatccgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
44986424 |
gtcttggacgacaatgttgtcttctttagtggaaaatggtaaatggggtgaagcttttgaaatctatgttaaaatgattgaatcaggtgtttatccgaat |
44986523 |
T |
 |
| Q |
101 |
gaatttacgtttgttaaattgttaggtgccgtgtcttcctttcttggtttatcgtatgggaaactgctgcatgcacatttaatcatgtttggtgctgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44986524 |
gaatttacgtttgttaaattgttaggtgccgtgtcttcctttcttggtttatcgtatgggaaactgctgcatgcacatttaatcatgtttggtgctgaat |
44986623 |
T |
 |
| Q |
201 |
tgaatttggtgttgaagacagctgttgttgatatgtattcaaaatgcagacggatggtcgatgctattaaggtttctaatctgacacctgaatatgatgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44986624 |
tgaatttggtgttgaagacagctgttgttgatatgtattcaaaatgcagacggatggtcgatgctattaaggtttctaatctgacacctgaatatgatgt |
44986723 |
T |
 |
| Q |
301 |
gtacttatggaccacccttatctctg |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44986724 |
gtacttatggaccacccttatctctg |
44986749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University