View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3034_high_19 (Length: 324)
Name: NF3034_high_19
Description: NF3034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3034_high_19 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 19 - 324
Target Start/End: Complemental strand, 26415092 - 26414786
Alignment:
| Q |
19 |
gctatgccggtttattcacggttttctaggtttaacagagttccgaataacggtttt-ggtttcaaccgcgaaattcgaagtcctgttgatagtcaaaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26415092 |
gctatgccggtttattcacggttttctaggtttaacagagttccgaataacggtttttggtttcaaccgcgaaattcgaagtcctgttgatagtcaaaga |
26414993 |
T |
 |
| Q |
118 |
tcttcttctgtttctagaagtcaatctcaatttgaagctgatcggtttgatttctccgacgaagttgccgccaccgccgaccgtcactccgtttctgttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414992 |
tcttcttctgtttctagaagtcaatctcaatttgaagctgatcggtttgatttctccgacgaagttgccgccaccgccgaccgtcactccgtttctgttt |
26414893 |
T |
 |
| Q |
218 |
ccagaactcaatctcaattcgaaaccgatcggtctgatttctccggtgaagtcgctgccgttgacaacggcagcgacgacggaaacgacgatgaaaacgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26414892 |
ccagaactcaatctcaattcgaaaccgatcggtctgatttctccggtgaagtcgctgccgttgacaacggcagcgacgacggaaacgacggtgaaaacgg |
26414793 |
T |
 |
| Q |
318 |
cgaaggt |
324 |
Q |
| |
|
||||||| |
|
|
| T |
26414792 |
cgaaggt |
26414786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University