View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3034_high_29 (Length: 243)
Name: NF3034_high_29
Description: NF3034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3034_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 21297711 - 21297933
Alignment:
| Q |
1 |
ttcaggtatgtcttcgattgttgtagaggcagagaagttgagagtgggagtttggttcatcgagtagtgtccaacttggttgtcgcttccgtggattgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
21297711 |
ttcaggtatgtcttcgattgttgtagaggcagagaagttgagagtgggagtttggttcatcgagtagtgtccaacttggttgtcgcttctgtgggttgtt |
21297810 |
T |
|
| Q |
101 |
gcagtgtgggtgcctgattgagcattccatccaggttcgttgaataaggaaccagagagttgtcggcagacgacagctccagcagcagatccattgggtg |
200 |
Q |
| |
|
||| || ||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21297811 |
gcattgcgggtgcctgattgcgcaatccagccaggttcgttgaataaggaaccagagagttgtcggcagacgacaactccagcagcagatccattgggtg |
21297910 |
T |
|
| Q |
201 |
agcattcagaaagcggttgagac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
21297911 |
agcattcagaaagcggttgagac |
21297933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University