View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3034_low_19 (Length: 326)
Name: NF3034_low_19
Description: NF3034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3034_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 7 - 150
Target Start/End: Complemental strand, 25610791 - 25610648
Alignment:
| Q |
7 |
tggaatttagtactcacatttcttcattgccgtgctgagttattaaaaagggtagaagaatatgtggaattagaggattgtgcaagagatgaagaaaaga |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25610791 |
tggaattcagtactcacatttcttcattgcggtgctgggttattaaaaagggtagaagaatatgtggaattaaaggattgtgcaagagatgaagaaaaga |
25610692 |
T |
 |
| Q |
107 |
aatgcaagaatcttgttagagttgcaaaagtgatggagaagaat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25610691 |
aatgcaagaatcttgttagagttgcaaaagtgatggagaagaat |
25610648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 25609765 - 25609725
Alignment:
| Q |
148 |
aatcttaatatgcattaacaggcaccaaaatcattgtaggt |
188 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
25609765 |
aatcttagtatgcaataactggcaccaaaatcattgtaggt |
25609725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University