View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3034_low_28 (Length: 253)
Name: NF3034_low_28
Description: NF3034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3034_low_28 |
 | |
|
| [»] scaffold0402 (2 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 19332032 - 19331858
Alignment:
| Q |
20 |
gaagacttgtaacacatgcaacatgatactcattgttcaagtcacaactgatgcaataaaatctggatctcctagggccacaaaaaattgttaagaacat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19332032 |
gaagacttgtaacacatgcaacatgatactcattgttcaagtcacaactgatgcaataaaatctggatctcctagggccacaaaaaattgttaagaacat |
19331933 |
T |
|
| Q |
120 |
agtttttgttgttttagcacttgctatctctttaaggtcattgtgctaaaaaagttgtaccagtcaacatttgtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19331932 |
agtttttgttgttttagcacttgctatctctttaaggtcattgtgctaaaaaagttgtaccaatcaacatttgtt |
19331858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 118
Target Start/End: Complemental strand, 19340654 - 19340556
Alignment:
| Q |
20 |
gaagacttgtaacacatgcaacatgatactcattgttcaagtcacaactgatgcaataaaatctggatctcctagggccacaaaaaattgttaagaaca |
118 |
Q |
| |
|
|||| ||||||| | ||||||||||||||| ||||| ||| |||| ||||||| ||||| |||||||| || ||||||||||||||| ||||||| |
|
|
| T |
19340654 |
gaagccttgtaataaatgcaacatgatacttattgtgcaaatcaccactgatgttataaaccttggatctcataaggccacaaaaaattggaaagaaca |
19340556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 19340502 - 19340454
Alignment:
| Q |
173 |
gttgtaccagtcaacatttgtttgagagctgttgaattaatattgaatt |
221 |
Q |
| |
|
|||||| |||||||||||||||||| | ||| || |||||||||||||| |
|
|
| T |
19340502 |
gttgtagcagtcaacatttgtttgataactgctgtattaatattgaatt |
19340454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 118
Target Start/End: Complemental strand, 3717 - 3619
Alignment:
| Q |
20 |
gaagacttgtaacacatgcaacatgatactcattgttcaagtcacaactgatgcaataaaatctggatctcctagggccacaaaaaattgttaagaaca |
118 |
Q |
| |
|
|||| ||||||| | ||||||||||||||| ||||| ||| |||| ||||||| ||||| |||||||| || ||||||||||||||| ||||||| |
|
|
| T |
3717 |
gaagccttgtaataaatgcaacatgatacttattgtgcaaatcaccactgatgttataaaccttggatctcataaggccacaaaaaattggaaagaaca |
3619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 3565 - 3517
Alignment:
| Q |
173 |
gttgtaccagtcaacatttgtttgagagctgttgaattaatattgaatt |
221 |
Q |
| |
|
|||||| |||||||||||||||||| | ||| || |||||||||||||| |
|
|
| T |
3565 |
gttgtagcagtcaacatttgtttgataactgctgtattaatattgaatt |
3517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University