View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3034_low_36 (Length: 220)

Name: NF3034_low_36
Description: NF3034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3034_low_36
NF3034_low_36
[»] chr8 (1 HSPs)
chr8 (20-76)||(31038462-31038518)


Alignment Details
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 31038518 - 31038462
Alignment:
20 cattcatgcttcttaaaagagattgagttcatgtttggttatatgtaaagtgattta 76  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
31038518 cattcatgcttcttaaaagagattgagttcatgtttggttacatgtaaagtgattta 31038462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University