View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3035_low_4 (Length: 240)
Name: NF3035_low_4
Description: NF3035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3035_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 229
Target Start/End: Original strand, 52459485 - 52459695
Alignment:
| Q |
19 |
caaaccttagaaggagcaggtcaatgtcctcggcttccttccaggtcaaagatccaactagatctcctacaagtagcattgctagtgatccgtatcatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52459485 |
caaaccttagaaggagcaggtcaatgtcctcggcttccttccaggtcaaagatccaactagatctcctacaagtagcattgctagtgatccgtatcatca |
52459584 |
T |
 |
| Q |
119 |
atttgagcattcgttggggtaagacccgataatctaactttgaaactgatgtttataataccttgtattagttacattttgcacatattaactttggctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52459585 |
atttgagcattcgttggggtaagacccgataatctaactttgaaactgatgtttataataccttgtattagttacattttgcacatattaactttggctg |
52459684 |
T |
 |
| Q |
219 |
tactttctgtg |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
52459685 |
tactttctgtg |
52459695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 1288227 - 1288161
Alignment:
| Q |
19 |
caaaccttagaaggagcaggtcaatgtcctcggcttccttccaggtcaaagatccaactagatctcc |
85 |
Q |
| |
|
||||||| ||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288227 |
caaacctaagacggagctggtcaatctcctcggcttccttccaggtcaaagatccaactagatctcc |
1288161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University