View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3035_low_5 (Length: 229)
Name: NF3035_low_5
Description: NF3035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3035_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 216
Target Start/End: Original strand, 16577917 - 16578120
Alignment:
| Q |
13 |
agcacagactcaaaccctacgtttctcaatcagcttctgtaattgctccttttttgctcccaccactttttcaactacttttcctttcttcaatagtata |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16577917 |
agcacacactcaaaccctacgtttctcaatcagcttctgtaattgctccttttttgctcccaccactttttcaactacttttcctttcttcaatagtata |
16578016 |
T |
|
| Q |
113 |
aatgttggcattgcttgcacctgaaatgcacttgccacctcctgttttcatacattttgcattatcatattattttagtaaaaatgttggatatatatag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16578017 |
aatgttggcattgcttgcacctgaaatgcacttgccacgtcctgttttcatacattttgcattatcatattattttagtaaaaatgttggatatatatag |
16578116 |
T |
|
| Q |
213 |
atat |
216 |
Q |
| |
|
|||| |
|
|
| T |
16578117 |
atat |
16578120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 59 - 138
Target Start/End: Original strand, 16571999 - 16572078
Alignment:
| Q |
59 |
tccttttttgctcccaccactttttcaactacttttcctttcttcaatagtataaatgttggcattgcttgcacctgaaa |
138 |
Q |
| |
|
||||||||||| || || || || ||||| |||||||||||||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
16571999 |
tccttttttgcccctacaaccttgtcaacaacttttcctttcttcatcagtatgaatgttggcattgcttgcacttgaaa |
16572078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 33 - 140
Target Start/End: Original strand, 16560632 - 16560739
Alignment:
| Q |
33 |
gtttctcaatcagcttctgtaattgctccttttttgctcccaccactttttcaactacttttcctttcttcaatagtataaatgttggcattgcttgcac |
132 |
Q |
| |
|
|||| ||||||| | | |||| || ||| ||| |||||||||||||||| ||||| |||||||||||||| | |||| ||| ||||||| || ||||| |
|
|
| T |
16560632 |
gtttttcaatcatcctttgtagttcctcttttcttgctcccaccactttatcaacaacttttcctttcttaatgagtaaaaaagttggcaatgaatgcac |
16560731 |
T |
|
| Q |
133 |
ctgaaatg |
140 |
Q |
| |
|
||| |||| |
|
|
| T |
16560732 |
ctggaatg |
16560739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University