View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3036-Insertion-13 (Length: 160)
Name: NF3036-Insertion-13
Description: NF3036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3036-Insertion-13 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 1e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 7 - 160
Target Start/End: Complemental strand, 6232634 - 6232481
Alignment:
| Q |
7 |
aattatcacaagaaggaaaagattttctagaaaagtgtttcattaaggatcctttgagaagatggacagcagatatgctcttcaaacatccgtttatctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232634 |
aattatcacaagaaggaaaagattttttagaaaagtgtttcattaaggatcctttgagaagatggacagcagatatgctcttcaaacatccgtttatctc |
6232535 |
T |
|
| Q |
107 |
cgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232534 |
cgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtc |
6232481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 7 - 160
Target Start/End: Complemental strand, 6221852 - 6221699
Alignment:
| Q |
7 |
aattatcacaagaaggaaaagattttctagaaaagtgtttcattaaggatcctttgagaagatggacagcagatatgctcttcaaacatccgtttatctc |
106 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||| |||||||||| | ||||||||| ||||| ||||| || |||||| ||||||||| |
|
|
| T |
6221852 |
aattatcacaagtcggaaaagattttctcgaaaagtgtttcatcaaggatccttcaaaaagatggacggcagagatgcttttgaaacatgagtttatctc |
6221753 |
T |
|
| Q |
107 |
cgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtc |
160 |
Q |
| |
|
| || ||||||||||||| | || || ||||| | |||||||||||||||| |
|
|
| T |
6221752 |
aggtgatgaaactgtttcattggtgaaagagttgatcaatgagttgccattgtc |
6221699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University