View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3036R-Insertion-7 (Length: 360)
Name: NF3036R-Insertion-7
Description: NF3036R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3036R-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 169 - 290
Target Start/End: Complemental strand, 40834019 - 40833897
Alignment:
| Q |
169 |
ctttatgttttattggtttactcgctaagctaagaatatgttaaaa-ctgttagaattgatctagccggcctaaggtctttcttaggcttaaacttcatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834019 |
ctttatgttttattggtttactcgctaaggtaagaatatgttaaaagctgttagaattgatctagccggcctaaggtctttcttaggcttaaacttcatt |
40833920 |
T |
|
| Q |
268 |
gtcactgttatacattaaaaaat |
290 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
40833919 |
gtctctgttatacattaaaaaat |
40833897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 290 - 360
Target Start/End: Complemental strand, 40833826 - 40833756
Alignment:
| Q |
290 |
tcttaaaaatggacatttatggaggaatgaaggaacagagcaagtatgtatgaaccgggtctttaatttcc |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40833826 |
tcttaaaaatggacatttatggaggaatgaaggaacagagcaagtatgtatgaaccgggtctttaatttcc |
40833756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 54 - 92
Target Start/End: Complemental strand, 40834150 - 40834112
Alignment:
| Q |
54 |
agagtttgaatttgaaataatcatgcatattctctttta |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834150 |
agagtttgaatttgaaataatcatgcatattctctttta |
40834112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 110 - 173
Target Start/End: Complemental strand, 40834114 - 40834045
Alignment:
| Q |
110 |
ttaaatgtcatgacaggcca---acatacttccttgcaaattact---ttgtttttgtataacagcttta |
173 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40834114 |
ttaaatgtcatgacaggcaacatacatacttccttgcaaattactactttgtttttgtataacagcttta |
40834045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University