View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3036_low_15 (Length: 246)
Name: NF3036_low_15
Description: NF3036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3036_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 8569232 - 8569000
Alignment:
| Q |
1 |
taattttttgttatttgattcttagcataatgttggatctggttgttttgattttctgatgatacattttgatatcctatgctatatttggtacttaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8569232 |
taattttttgttatttgattcttagcataatgttggatctggttgttttgattttctgatgacacattttgatatagtatgctatatttggtacttaaat |
8569133 |
T |
|
| Q |
101 |
ctttttaatattttctaattttaatgtgttgctgtttgactttttgaaattgaatgtcttactatatgctcataagaagagtcatcactaataattcaca |
200 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569132 |
ctttttgatattttccaattttaatgtgttgctgtttgactttttgaaattgaatgtcttactatatgctcataagaagagtcatcactaataattcaca |
8569033 |
T |
|
| Q |
201 |
gatttcatcatggctttacctaccaagtaattg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8569032 |
gatttcatcatggctttacctaccaagtaattg |
8569000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 98
Target Start/End: Complemental strand, 34568543 - 34568472
Alignment:
| Q |
27 |
ataatgttggatctggttgttttgattttctgatgatacattttgatatcctatgctatatttggtacttaa |
98 |
Q |
| |
|
||||||| ||| ||| |||||||| || |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
34568543 |
ataatgtgggagctgcttgttttgcttctctgatgaaacattttgatacaatatgctatatttggtacttaa |
34568472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University