View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037-Insertion-10 (Length: 170)
Name: NF3037-Insertion-10
Description: NF3037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037-Insertion-10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 20 - 170
Target Start/End: Original strand, 39168373 - 39168524
Alignment:
| Q |
20 |
tgttaggagaatcattcacaacgatcaaggtttttctttctatttcaatagtg-agtgtagctcgtgctggacatcttgtggattgtataaggcgcacag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39168373 |
tgttaggagaatcattcacaacgatcaaggtttttctttctatttcagtagtgtagtgtagctcgtgctggacatcttgtggattgtataaggcgcacag |
39168472 |
T |
 |
| Q |
119 |
ttcctatcaagactcgttgtcattccattccttctgagattaaataccattt |
170 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39168473 |
ttcctatcaagactcgttgtgattccattccttctgagattaaataccattt |
39168524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University