View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037-Insertion-11 (Length: 144)
Name: NF3037-Insertion-11
Description: NF3037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037-Insertion-11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 144
Target Start/End: Complemental strand, 45130201 - 45130065
Alignment:
| Q |
8 |
ctttcaacaattctcaggatatgtcacagttgataacaaaaaacacaagtcacttttttactactttgctgaatcagaaactgatccttcttcaaaacct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45130201 |
ctttcaacaattctcaggatatgtcacagttgataacaaaaaacacaagtcacttttttactactttgctgaatcagaaactgatccttcttcaaaacct |
45130102 |
T |
|
| Q |
108 |
cttgttctttggctcaatggaggacctggttgttctt |
144 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45130101 |
cttgttctttggctcaatggtggacctggttgttctt |
45130065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 40282341 - 40282219
Alignment:
| Q |
8 |
ctttcaacaattctcaggatatgtcacagttgataacaaaaaacacaagtcacttttttactactttgctgaatcagaaactgatccttcttcaaaacct |
107 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| | ||||||| || | || |||||||| |||| |||||||||||||| ||| |||||||| ||| |
|
|
| T |
40282341 |
ctttcaacacttctcaggatatgttacagttgatgaaaaaaaacgcagatatctcttttactattttgttgaatcagaaactggtccatcttcaaagcct |
40282242 |
T |
|
| Q |
108 |
cttgttctttggctcaatggagg |
130 |
Q |
| |
|
| || ||||||||||||||||| |
|
|
| T |
40282241 |
ttagtcctttggctcaatggagg |
40282219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University