View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037-Insertion-13 (Length: 115)
Name: NF3037-Insertion-13
Description: NF3037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037-Insertion-13 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 6e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 2606618 - 2606511
Alignment:
| Q |
8 |
caaataacagcttgcacgaatgaaaggttcaactaggtggttgcaagttcgtgtctacataagcttaggcaaccactagtaagggtggcaaaacgtgtgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2606618 |
caaataacagcttgcacgaatgaaaggttcaactaggtggttgcaagttcgtgtctgcatgagcttaggcaaccactagtaagggtggcaaaacgtgtgt |
2606519 |
T |
|
| Q |
108 |
caacatat |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
2606518 |
caacatat |
2606511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 25 - 101
Target Start/End: Complemental strand, 2605105 - 2605029
Alignment:
| Q |
25 |
gaatgaaaggttcaactaggtggttgcaagttcgtgtctacataagcttaggcaaccactagtaagggtggcaaaac |
101 |
Q |
| |
|
||||||||| |||||||| || ||||||| |||| ||||| || ||| ||||||||||||| ||||| ||| ||||| |
|
|
| T |
2605105 |
gaatgaaagattcaactatgttgttgcaatttcgagtctatatgagcctaggcaaccactaataaggatggtaaaac |
2605029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University