View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037-Insertion-14 (Length: 90)
Name: NF3037-Insertion-14
Description: NF3037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037-Insertion-14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 11 - 90
Target Start/End: Original strand, 29757708 - 29757788
Alignment:
| Q |
11 |
tttccttagttatccttcctttgaaa-aaacaatggaagctttcttgattttcgttctttccgtccacaacctatccatcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29757708 |
tttccttagttatccttcctttgaaacaaacaatggaagctttcttgattttcgttctttatgtccacaacctatccatcc |
29757788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 15 - 90
Target Start/End: Original strand, 19598253 - 19598330
Alignment:
| Q |
15 |
cttagttatccttcctttgaaaa--aacaatggaagctttcttgattttcgttctttccgtccacaacctatccatcc |
90 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19598253 |
cttagttatccttcctttcaaaacaaacaatggaagctttcttgattttcgttctttttgtccacaacctatccatcc |
19598330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University