View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037R-Insertion-2 (Length: 148)
Name: NF3037R-Insertion-2
Description: NF3037R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037R-Insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 34442164 - 34442275
Alignment:
| Q |
8 |
agcaacaagcacctcttgcgatgcatgatatgcactagaatgtgtggcttccagtcactcacactccaagattatgtctttgaaggaaagactcaactct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34442164 |
agcaacaagcacctcttgcgatgcatgatatgcactagaatgcgtggcttccagtcactcacactccaagattatgtctttgaaggaaagactcaactct |
34442263 |
T |
|
| Q |
108 |
tcttccacaggt |
119 |
Q |
| |
|
||||||| |||| |
|
|
| T |
34442264 |
tcttccataggt |
34442275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University