View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037_low_16 (Length: 262)
Name: NF3037_low_16
Description: NF3037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 116 - 244
Target Start/End: Complemental strand, 45130326 - 45130197
Alignment:
| Q |
116 |
atggcaatgacaatgtctatgttatttcttcatctcannnnnnn-accatgaaagtgttttgtttttctcctcattttcatgcagacaaaattgttaccc |
214 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45130326 |
atggcaatgacaatgtctattttatttcttcatctcattttttttaccatgaaagtgttttgtttctctcctcattttcatgcagacaaaattgttaccc |
45130227 |
T |
|
| Q |
215 |
ttcctggacaaccacaaaacatagcctttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45130226 |
ttcctggacaaccacaaaacatagcctttc |
45130197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 45130426 - 45130357
Alignment:
| Q |
22 |
ttgtacttctcacgacactagtcacttactcatcatca---tcattttaaataaatacaccactccatca |
88 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
45130426 |
ttgtacttctcacaacactagtcacttactcatcatcatcatcattttaaataaatacaccaccccatca |
45130357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University