View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037_low_19 (Length: 231)
Name: NF3037_low_19
Description: NF3037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 7 - 172
Target Start/End: Original strand, 27234108 - 27234273
Alignment:
| Q |
7 |
aagctaacgtgaggtgaatccatcaagcttgagatgagcctgtctaacttccttgaatttagtctaattgattttgagcttgaaataacccatcatttca |
106 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27234108 |
aagctaacgtgaggtgattccatcaagcttgagatgagcctgtctaacttccttgaatttaggataattgattttgagcttgaaataacccagcatttca |
27234207 |
T |
 |
| Q |
107 |
ttcatcaatcggtgcgtgtgatggaaacaattagagcaagatcgagattgggaataatcatagagg |
172 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| || ||||| |
|
|
| T |
27234208 |
tgcatcaatcggtgcgtgtgatggaaacaattacagcaagagcgagattgggaataagcagagagg |
27234273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University