View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3037_low_23 (Length: 224)
Name: NF3037_low_23
Description: NF3037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3037_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 36357265 - 36357455
Alignment:
| Q |
18 |
gttatagacatgtataaggtatatatatgcatgaaatccagatgaaaaatcatgacacatataaatacttgaagaaatgttacataaacttcaatgtgac |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36357265 |
gttatagacatgtataaggtata----tgcatgaaatccagatgaaaaatcatgacacatataaatacttgaagaaatgttacataaacttcaatgtgac |
36357360 |
T |
 |
| Q |
118 |
aggtataattgtaccaaattttagataaatataattgaattaaaagagcttgacattataccaactgttttccagtctcattgcggatctctgct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
36357361 |
aggtataattgtaccaaattttagataaatataattgaattaaaagagcttgacattataccaactgtgttccagtctcattgcggatccctgct |
36357455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University