View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3038_high_10 (Length: 260)
Name: NF3038_high_10
Description: NF3038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3038_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 6 - 157
Target Start/End: Complemental strand, 46676704 - 46676553
Alignment:
| Q |
6 |
cacagaagaggatgcaattgcaggaaatcaagctgcatgaagaattattgcaaatgttgagannnnnnnnccattgtttacatatcatgtatatttttaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46676704 |
cacagaagaggatgcaattgcaggaaatcaagctgcatgaagaattattgcaaatgttgaggttttttttccattgtttacatatcatgtatatttttaa |
46676605 |
T |
|
| Q |
106 |
tttcatttataataatatgaattacaatgggtggttttcttttgaagaaaca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46676604 |
tttcatttataataatatgaattacaatgggtggttttcttttgaagaaaca |
46676553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 76 - 152
Target Start/End: Complemental strand, 46702786 - 46702710
Alignment:
| Q |
76 |
ccattgtttacatatcatgtatatttttaatttcatttataataatatgaattacaatgggtggttttcttttgaag |
152 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46702786 |
ccattgtttacatattatgtatgtttttaatttcatttataataatatgaattacaatggatggttttcttttgaag |
46702710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 213 - 245
Target Start/End: Complemental strand, 46676520 - 46676488
Alignment:
| Q |
213 |
gatgtccaatattgatctctattcgtttgtttg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46676520 |
gatgtccaatattgatctctattcgtttgtttg |
46676488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University