View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3038_high_12 (Length: 255)

Name: NF3038_high_12
Description: NF3038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3038_high_12
NF3038_high_12
[»] chr4 (1 HSPs)
chr4 (13-237)||(49671729-49671958)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 49671729 - 49671958
Alignment:
13 tgagatgaaattatggatgttttttgggatgataatgggaatggacaatgagacctaaaattcggccactttttgggttttggctttttgaacatgtggc 112  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49671729 tgagatgaaattatggatgctttttgggatgataatgggaatggacaatgagacctaaaattcggccactttttgggttttggctttttgaacatgtggc 49671828  T
113 ttgagagagaaggagagtggcatctctttgggttgg-----tgccttgtgtatctccttgctcccttttctcttttccattgttgaaattgaggtaaatc 207  Q
    ||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49671829 ttgagagagaaggagagtggcatctctttgggttggtgccttgccttgtgtatctccttgctcccttttctcttttccattgttgaaattgaggtaaatc 49671928  T
208 gtcctactttcctaagtcccacaccgcatt 237  Q
    ||||||||||||||||||||||||||||||    
49671929 gtcctactttcctaagtcccacaccgcatt 49671958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University