View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3038_high_21 (Length: 221)
Name: NF3038_high_21
Description: NF3038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3038_high_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 19988462 - 19988670
Alignment:
| Q |
16 |
gaaacaacatttgagtccaatttagcaagcaaagcttcctcagataaatgttgccaaagtggctttttgttcaatgatgatggtnnnnnnnnnnnnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19988462 |
gaaacaacatttgagtccaatttagcaagcaaagcttcctcggataaatgttgccaaagtggcttcttgttcaatgatgatggtgaagaagaagaagaag |
19988561 |
T |
 |
| Q |
116 |
nn---atgttcttctccattggagtgtcaaaatttggttcatcgtcatcgtcatcaaggccatccatgagttcccaagcgttgatgaccgagtcagggga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
19988562 |
aagaaatgttcttctccattggagtgtcaaaatttggttcatcgtcaacatcatcaaggccatccatgagttcccaagcgttgatgactgagtcaggtga |
19988661 |
T |
 |
| Q |
213 |
caatgattc |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
19988662 |
caatgattc |
19988670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 35420395 - 35420441
Alignment:
| Q |
31 |
tccaatttagcaagcaaagcttcctcagataaatgttgccaaagtgg |
77 |
Q |
| |
|
||||| ||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
35420395 |
tccaacttagcaagcaaagcttcttctgataaatgctgccaaagtgg |
35420441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University