View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3038_low_18 (Length: 255)
Name: NF3038_low_18
Description: NF3038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3038_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 49671729 - 49671958
Alignment:
| Q |
13 |
tgagatgaaattatggatgttttttgggatgataatgggaatggacaatgagacctaaaattcggccactttttgggttttggctttttgaacatgtggc |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49671729 |
tgagatgaaattatggatgctttttgggatgataatgggaatggacaatgagacctaaaattcggccactttttgggttttggctttttgaacatgtggc |
49671828 |
T |
 |
| Q |
113 |
ttgagagagaaggagagtggcatctctttgggttgg-----tgccttgtgtatctccttgctcccttttctcttttccattgttgaaattgaggtaaatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49671829 |
ttgagagagaaggagagtggcatctctttgggttggtgccttgccttgtgtatctccttgctcccttttctcttttccattgttgaaattgaggtaaatc |
49671928 |
T |
 |
| Q |
208 |
gtcctactttcctaagtcccacaccgcatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49671929 |
gtcctactttcctaagtcccacaccgcatt |
49671958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University