View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3038_low_28 (Length: 218)

Name: NF3038_low_28
Description: NF3038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3038_low_28
NF3038_low_28
[»] chr4 (1 HSPs)
chr4 (126-202)||(24571197-24571273)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 24571273 - 24571197
Alignment:
126 ctaaaagactttctatgcaggtcgtagattggtacgaacttgggtccctcgttggcaaagcttgtggatgaatttta 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
24571273 ctaaaagactttctatgcaggtcgtagattggtacgaacttgggtccctagttggcaaagcttgtggatgaatttta 24571197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University