View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3038_low_8 (Length: 363)
Name: NF3038_low_8
Description: NF3038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3038_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 18 - 165
Target Start/End: Complemental strand, 5413594 - 5413447
Alignment:
| Q |
18 |
aatttatctctggcctaatgtctttgccaataaacctaccaggaaccaaactctatcaatctttacaggtagtaatgagattgatttcttctaccatata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5413594 |
aatttatctctggcctaatgtctttgccaataaacctaccaggaaccaaactctatcaatctttacaggtagtaatgagattgatttcttctaccatata |
5413495 |
T |
|
| Q |
118 |
tagcatgctttgctgaaagtaatgatgacttcacatttggtttcaggc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5413494 |
tagcatgctttgctgaaagtaatgatgacttcacatttggtttcaggc |
5413447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 222 - 352
Target Start/End: Complemental strand, 5413390 - 5413260
Alignment:
| Q |
222 |
gcatctttgaagttccaagagatgtagtggatgtccttcttaatgatacaagtgagaaattgacagatgatttaatagcagataatattattgatatgat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5413390 |
gcatctttgaagttccaagagatgtagtggatgtccttcttaatgatacaagtgagaaattgacagatgatttaatagcagataatattattgatatgat |
5413291 |
T |
|
| Q |
322 |
gattcctggagaggactcagttccagttctt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5413290 |
gattcctggagaggactcagttccagttctt |
5413260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University