View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_high_47 (Length: 249)
Name: NF3039_high_47
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 15247314 - 15247098
Alignment:
| Q |
16 |
atcaataaaatgttaatgaggttgagtaccaatactcattaaagaacttacatgactgccagtgtcaaactgagttagggttccaaaattatttgatagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15247314 |
atcaataaaatgttaatgaggttgagtaccaatactcattaaagaacctacatgactgccagtgtcaaactgagttagggttccaaaattatttgatagc |
15247215 |
T |
 |
| Q |
116 |
cgttttgcacgaatgagatcttcttttgttgttctttgaacaggaattgttccttcaggacatgaatctttatcaagtccaatatttaaatatctttctg |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
15247214 |
cgttttgaacgaatgagatcttcttttgttgttctttgaacaggaattgttccttcaggacatgaatctttatcaagtccaatttttaaatatcttcctg |
15247115 |
T |
 |
| Q |
216 |
atatatcatgtgtcttt |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15247114 |
atatatcatgtgtcttt |
15247098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 101 - 170
Target Start/End: Complemental strand, 15229211 - 15229142
Alignment:
| Q |
101 |
aaattatttgatagtcgttttgcacgaatgagatcttcttttgttgttctttgaacaggaattgttcctt |
170 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
15229211 |
aaattatttgatagccgtttcgcacgaatgagatcatcttttgttgttctctggacaggaattgttcctt |
15229142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University