View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_high_56 (Length: 239)
Name: NF3039_high_56
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_high_56 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] scaffold0508 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 40672933 - 40672713
Alignment:
| Q |
19 |
gccgtttcgatcacgaagaaagaattcgcaagaaagaggctcgtaaagctcacaagcactctaaacaggcccagcaggtttaatttaaatcacttttatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40672933 |
gccgtttcgatcacgaagaaagaattcgcaagaaagaggctcgtaaagctcacaagcactctaaacaggcccagcaggtttaatttaaatcacttttatt |
40672834 |
T |
 |
| Q |
119 |
tatttaaacaaagttatgtgtttgtgtatattgtcataaatctaactgggtttctgtttgattccactggaacaggctattggtattaagggtaagcaga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40672833 |
tatttaaacaaagttatgtgtttgtgtatattgtcataaatctaactgggtttctgtttaattccactggaacaggctattggtattaagggtaagcaga |
40672734 |
T |
 |
| Q |
219 |
ttgccaagaaaaattatgccg |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40672733 |
ttgccaagaaaaattatgccg |
40672713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0508 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0508
Description:
Target: scaffold0508; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 145 - 239
Target Start/End: Original strand, 8093 - 8187
Alignment:
| Q |
145 |
tatattgtcataaatctaactgggtttctgtttgattccactggaacaggctattggtattaagggtaagcagattgccaagaaaaattatgccg |
239 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||| | |||||||| |||||||| |||||| ||| | |||||||||||||||||||| |
|
|
| T |
8093 |
tatattgtcataaatctaaatgggtatctgtttaattcgagtggaacagactattggtcataagggaaagagaaatgccaagaaaaattatgccg |
8187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University