View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_high_57 (Length: 238)
Name: NF3039_high_57
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_high_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1295603 - 1295815
Alignment:
| Q |
1 |
taagtaatatatcttttaccctcactactacctaacagtgttgctgtttgagttttagttgccctgcagcacatgtacgctacaattacattggagcagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1295603 |
taagtaatatatcttttaccctcactaccacctaacagtgttgctgtttgagttttagttgccctgcagcacatgtacgctacaattaca--------gt |
1295694 |
T |
 |
| Q |
101 |
ttgaattgacttatatgagttgatctactattgtaagtacttgtaagattatttaggagaacttataaacaacgttagttccatgcataaaaacatctta |
200 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1295695 |
ttgaattgacttatacgagtttatctactatcgtaagtacttgtaagactatttagaagaacttataaacaacgttagttccatgcataaaaatatctta |
1295794 |
T |
 |
| Q |
201 |
tagtttatacggaaacaattt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1295795 |
tagtttatacggaaacaattt |
1295815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University