View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_high_66 (Length: 218)
Name: NF3039_high_66
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_high_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 32396347 - 32396150
Alignment:
| Q |
1 |
accaagcacacccctatttttccctctttgtttctgtttgattggcttatatgctgaaattgattttgcggggctcgcctaaggcatgataaagtcaagg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32396347 |
accaagcacacccctattttcccctctttgtttctgtttgattggcttatatgctgaaattgattttgcggggctcgcctaaggcatgataaagtcaagg |
32396248 |
T |
 |
| Q |
101 |
tctattacctatgtccacttttcatggtcccccgacatttggttagatttgtgtggaagctattaaatgttaagagcttagaccctttgtggtggtga |
198 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32396247 |
tctattacctatatccacttttcatggtcccccggcatttggttagatttgtgtggaagctattaaaagttaagagcttagaccctttgtggtggtga |
32396150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University