View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_high_67 (Length: 217)
Name: NF3039_high_67
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 196131 - 195941
Alignment:
| Q |
18 |
gttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaacggttaattggttaataaagagata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
196131 |
gttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaatggttaattggttaataaagagata |
196032 |
T |
 |
| Q |
118 |
atgcattgggatagttaataaccgtgcatgccattaaggttttacatttggtttctatattttaatttcatgttatgtcattcatctcact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
196031 |
atgcattgggatagttaataaccgtgcatgccattaaggttttacatttggtttctatattttaatttcatgttatgtcattcagctcact |
195941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University